IGR sequence: | igr825#chr4#x1=4610337#l=1222 |
---|---|
Mature miRNA sequence: | CUAAUUUGAAACGGAGGGAAUA |
encoded miRNA: | MIR52 |
Precursor location: | 325 - 570 (negative strand) |
precursor length: | 246 (66 basepairs) |
MIR position: | 225 - 246 (325 - 346) |
MIR length: | 22 (17 paired bases) |
miRNA location TIGR v3: | chr4:4610661<4610906 |
miRNA location TIGR v5: | chr4:5645667<5645912 |
Folding energy: | -43.04 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCAAUC CGUUUUAAAU UAAUUGUCGU UUAAAGAAAA UUUUACGUAU AUUUAAAAAA 60 :::(((--(( (((((((((( ((-((((((( ((,,<<<<<< ----<<<<<< <<<_____>> UAUAUGUUUU UCUAUUUUAC UCUAAUAAGU GUAUUUUUUU GUAUUAUCAU CAAUUAAUUA 120 >>>>>>>>>> >>>,,,,,,, ,,,,,,,<<< <<<--<<<<< <--------< <<<<______ AUAAACUACA AAAAUAAAAA UAACAUUGGA AAAUUUGUCA AAAAUCUGCA UUAAAACAUA 180 __________ __________ ____>>>>>- -------->> >>>>-->>>> >>,,,,,,,, ****** ********** AUACAACAAC UGAUUUAAAU CAAAAUUUAA CUCUAAAGUG ACAACUAAUU UGAAACGGAG 240 ,,,,,,,,,, ,<<-<<<<<< ____>>>>>> ->>,,))))) ))))-))))) )))))))))- ****** GGAAUA 246 ))):::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2323_75241+75512_1-22