IGR sequence: | igr812#chr2#x1=4252437#l=6609 |
---|---|
Mature miRNA sequence: | GGGUGAAUCCAUUCAUUGAC |
encoded miRNA: | MIR45 |
Precursor location: | 5559 - 5657 (negative strand) |
precursor length: | 99 (39 basepairs) |
MIR position: | 80 - 99 (5559 - 5578) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr2:4257995<4258093 |
miRNA location TIGR v5: | chr2:4316608<4316706 |
Folding energy: | -54.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GUUAAUGAAA GAGGUUCACC CCUAGGGGGU GAAUCUAUUC AUUCACCCCU UUGAACAAUU 60 (((((((((- (-(((((((( (((((((((( (((((((--- -((((_____ _))))----- * ********** ********* CUUGGGUUCA CCCCCUAGGG GGUGAAUCCA UUCAUUGAC 99 --)))))))) )))))))-)) )))))))))- )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3081_115891+116048_1-20
- gnl|BL_ORD_ID|3081_115891-116047_138-157
- gnl|BL_ORD_ID|3081_115891-116050_141-160
- gnl|BL_ORD_ID|1013_33832+33989_1-20
- gnl|BL_ORD_ID|1013_33832-33988_138-157
- gnl|BL_ORD_ID|1013_33832-33991_141-160
- gnl|BL_ORD_ID|167_4094-4250_138-157
- gnl|BL_ORD_ID|167_4094-4253_141-160
- gnl|BL_ORD_ID|167_4094+4251_1-20