IGR sequence: | igr7#chr1#x1=40945#l=4403 |
---|---|
Mature miRNA sequence: | CCGAGAUUUAAAACCCUAGU |
encoded miRNA: | MIR38 |
Precursor location: | 3988 - 4141 (positive strand) |
precursor length: | 154 (49 basepairs) |
MIR position: | 135 - 154 (4122 - 4141) |
MIR length: | 20 (17 paired bases) |
miRNA location TIGR v3: | chr1:44932>45085 |
miRNA location TIGR v5: | chr1:44932>45085 |
Folding energy: | -47.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
ACUAGGGUUU GUGUGAUUUC UGGUGUAAGA AGGUAAAAGG AGGUAGUUAU CAGAUGGGCC 60 (((((((((( ----(((((( -((----((( --(-(((((( --((((,,,, ,,,,<<<<<< CACUUGAAAU CAUUUCACUG GGCCUAAACA AAUAUAAAGC CCAUUUAUCA UUUAUGGCCU 120 <<--<<<<__ ___>>>>->> >>>>>>,,,, ,,,<<<<<__ ___>>>>>,, ,))))--))) ****** ********** **** UUUUCAGUCU CCUCCCGAGA UUUAAAACCC UAGU 154 )))-)--))) ---))-)))) ))--)))))) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|620_130995-131184_1-20