IGR sequence: | igr783#chr2#x1=4089755#l=13602 |
---|---|
Mature miRNA sequence: | UUCCACAGCUUUCUUGAACU |
encoded miRNA: | MIR15 |
Precursor location: | 1048 - 1178 (negative strand) |
precursor length: | 131 (37 basepairs) |
MIR position: | 1 - 20 (1159 - 1178) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr2:4090802<4090932 |
miRNA location TIGR v5: | chr2:4149415<4149545 |
Folding energy: | -39.40 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster033 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UUCCACAGCU UUCUUGAACU GCAAAACUUC UUCAGAUUUU UUUUUUUUUC UUUUGAUAUC 60 (((((((((( ((-((((((( (((((-(-(( --((((,,,, ,,,,,,,,<< ____>>,,,, UCUUACGCAU AAAAUAGUGA UUUUCUUCAU AUCUCUGCUC GAUUGAUUUG CGGUUCAAUA 120 ,,,,,,,,,, ,,,,,,<<<< ______>>>> ,,,))))--- ))--)-)))) ))))))))-) AAGCUGUGGG A 131 )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g34530.1 | 68409.m03832 hypothetical protein | 2 | 1 |
2 | At3g14110.1 | 68410.m01600 tetratricopeptide repeat (TPR)-containing protein | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1525_12876-12996_1-20
- gnl|BL_ORD_ID|1525_12876+12996_102-121
- gnl|BL_ORD_ID|393_115331-115451_1-20
- gnl|BL_ORD_ID|393_115331+115451_102-121