IGR sequence: | igr783#chr2#x1=4089755#l=13602 |
---|---|
Mature miRNA sequence: | UCUUCCACAGCUUUCUUGAACUGCA |
encoded miRNA: | MIR14 |
Precursor location: | 1046 - 1180 (negative strand) |
precursor length: | 135 (37 basepairs) |
MIR position: | 1 - 25 (1156 - 1180) |
MIR length: | 25 (22 paired bases) |
miRNA location TIGR v3: | chr2:4090800<4090934 |
miRNA location TIGR v5: | chr2:4149413<4149547 |
Folding energy: | -40.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster028 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** UCUUCCACAG CUUUCUUGAA CUGCAAAACU UCUUCAGAUU UUUUUUUUUU UCUUUUGAUA 60 ::(((((((( ((((-((((( (((((((-(- ((--((((,, ,,,,,,,,,, <<____>>,, UCUCUUACGC AUAAAAUAGU GAUUUUCUUC AUAUCUCUGC UCGAUUGAUU UGCGGUUCAA 120 ,,,,,,,,,, ,,,,,,,,<< <<______>> >>,,,))))- --))--)-)) )))))))))) UAAAGCUGUG GGAAG 135 -))))))))) )))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g07530.1 | 68408.m00734 scarecrow-like transcription factor 14 (SCL14) | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|1525_20451-20588_1-25
- gnl|BL_ORD_ID|696_38560-38659_1-25
- gnl|BL_ORD_ID|696_38560+38659_76-100