IGR sequence: | igr783#chr2#x1=4089755#l=13602 |
---|---|
Mature miRNA sequence: | GUUCAAUAAAGCUGUGGGAA |
encoded miRNA: | MIR92 |
Precursor location: | 1047 - 1178 (negative strand) |
precursor length: | 132 (37 basepairs) |
MIR position: | 113 - 132 (1047 - 1066) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:4090801<4090932 |
miRNA location TIGR v5: | chr2:4149414<4149545 |
Folding energy: | -40.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUCCACAGCU UUCUUGAACU GCAAAACUUC UUCAGAUUUU UUUUUUUUUC UUUUGAUAUC 60 (((((((((( ((-((((((( (((((-(-(( --((((,,,, ,,,,,,,,<< ____>>,,,, ******** UCUUACGCAU AAAAUAGUGA UUUUCUUCAU AUCUCUGCUC GAUUGAUUUG CGGUUCAAUA 120 ,,,,,,,,,, ,,,,,,<<<< ______>>>> ,,,))))--- ))--)-)))) ))))))))-) ********** ** AAGCUGUGGG AA 132 )))))))))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1525_20452+20587_1-20
- gnl|BL_ORD_ID|1525_20452-20586_116-135