IGR sequence: | igr1051#chr3#x1=4116016#l=6048 |
---|---|
Mature miRNA sequence: | CUUAUAUUAUGAAACGAAGG |
encoded miRNA: | MIR90b |
Precursor location: | 2496 - 2670 (negative strand) |
precursor length: | 175 (59 basepairs) |
MIR position: | 156 - 175 (2496 - 2515) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr3:4118511<4118685 |
miRNA location TIGR v5: | chr3:4118511<4118685 |
Folding energy: | -35.92 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUGUUUU ACAAUAUAAG UUGUUUUCAA GUUUUUAUGC AAAUUAUAUA AUAUUUUAAU 60 :((((((((( (-(((((((( (((((((--( (-------(( (,<<<<<<<< <<<<-<<<<< AAUUUAUGAU UAAUUAUAUU AUGUAGUCUC UUUUCUAAUU GGUUAAACUU UUUAAAAAUA 120 ________>> >>>-->>>>> >>>>>>>,,, ,,,,,,,,,, <<<<<<<<-- <<<<____>> ***** ********** ***** AAUGUUCUUA AUCUACGUGC UUUUAUCUAA AACAACUUAU AUUAUGAAAC GAAGG 175 >>->>-->>> >>>,,,,))) ------)))) )))))))))) )))-)))))) )))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2930_112178-112301_105-124
- gnl|BL_ORD_ID|2930_112178+112301_1-20