IGR sequence: | igr722#chr4#x1=3959983#l=2756 |
---|---|
Mature miRNA sequence: | UGCAUGAUAAGUUGUAAAGA |
encoded miRNA: | MIR7 |
Precursor location: | 2004 - 2212 (negative strand) |
precursor length: | 209 (75 basepairs) |
MIR position: | 190 - 209 (2004 - 2023) |
MIR length: | 20 (15 paired bases) |
miRNA location TIGR v3: | chr4:3961986<3962194 |
miRNA location TIGR v5: | chr4:4996992<4997200 |
Folding energy: | -55.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCUUUACAAU GGUGUAGUUU AGGUAUUUUU CUGAUUAACG GUUGAAUUUA GGUGAAUUGU 60 (((((((((( -(((((,,<< <<<-<<<<-< <<<<<,,,,[ [[[[[[[--- [[[[[----- UUGGUGGUUU GGAAUGUGUA CGGAAUUACC GUUGAUCACU CGUUCGAUCU GAAGAUAUGA 120 -[[[[[[[[[ -[________ ]-]]]]]]]] ]----]]]]] -]]]]]]]], [[[[[[[___ AUAUCUUUGU CAGGUGAGUU CUAACUCCCA UUUAAAUUAG GAGUGGGAAA AUUAAUUAAU 180 _]]]]]]]>> >>>>->>>>> >>>>,[[[[[ [[[_______ ]]]]]]]],, [[[[[[[___ * ********** ********* UAAAUUAGUU GCAUGAUAAG UUGUAAAGA 209 __]]]]]]]) ))))-----) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1552_81436+81618_1-20