IGR sequence: | igr5885#chr1#x1=27307304#l=7297 |
---|---|
Mature miRNA sequence: | UUGGAUUGAAGGGAGCUCUACAUCU |
encoded miRNA: | MIR41 |
Precursor location: | 5715 - 5906 (negative strand) |
precursor length: | 192 (69 basepairs) |
MIR position: | 168 - 192 (5715 - 5739) |
MIR length: | 25 (22 paired bases) |
miRNA location TIGR v3: | chr1:27313018<27313209 |
miRNA location TIGR v5: | chr1:27716890<27717081 |
Folding energy: | -78.80 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR159a |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GGAAGUAGAG CUCCUUAAAG UUCAAACAUG AGUUGAGCAG GGUAAAGAAA AGCUGCUAAG 60 (((-(((((( ((((((--(( ((((((---( (((-(((((( (((((---(( ((((-((-(( CUAUGGAUCC CAUAAGCCCU AAUCCUUGUA AAGUAAAAAA GGAUUUGGUU AUAUGGAUUG 120 -((((-(--( ((((((((-- (((((((___ ________)) )))))-)))) -)))))--)- *** ********** CAUAUCUCAG GAGCUUUAAC UUGCCCUUUA AUGGCUUUUA CUCUUCUUUG GAUUGAAGGG 180 ))))-))-)) -))))))--- )))))))--- ---))))--) )))---)))) ))))--)))) ********** ** AGCUCUACAU CU 192 ))))))))-) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2010_122533+122718_1-25
- gnl|BL_ORD_ID|2010_122533-122719_163-187
- gnl|BL_ORD_ID|500_35224+35409_1-25
- gnl|BL_ORD_ID|500_35224-35410_163-187