IGR sequence: | igr5691#chr1#x1=26486707#l=1307 |
---|---|
Mature miRNA sequence: | CGGAGGAACUCGUCGCCGUC |
encoded miRNA: | MIR8 |
Precursor location: | 157 - 361 (negative strand) |
precursor length: | 205 (56 basepairs) |
MIR position: | 1 - 20 (342 - 361) |
MIR length: | 20 (16 paired bases) |
miRNA location TIGR v3: | chr1:26486863<26487067 |
miRNA location TIGR v5: | chr1:26890735<26890939 |
Folding energy: | -59.09 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CGGAGGAACU CGUCGCCGUC GUUUCUUCAG CCCAUUGUAU UCGAGAAAUU UCAAGAGAAC 60 :((-((((-( (((((((((, ,,,,,,,,<< <<-<<<<<<< <,[[[[[--[ [[____]]]- GAUUCUCUUC GCUGUGAUUU UCUUAGCUAU CUUCCCUCCU CUCUACUUCC AUUUCAAGCU 120 --]]]]],,, [[-[[[[[-- [[,,{{{{__ __________ __________ ______}}}} CCGACGAAUU CGUCAGAUUG UCGCGCAAAA GUGCGAUUGG CUUCACCAUC CUCCACUUGU 180 ,,{{{{____ }}}},]]--] ]]]]]],,,> >>>>>>>->> >>,,,,,,,, ,,,{{{____ CUGUGCUCAC GGCGGCGAUU CCACC 205 __}}},,,)) )))))))))) ))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|942_84696-84851_1-20