IGR sequence: | igr563#chr3#x1=2196551#l=2807 |
---|---|
Mature miRNA sequence: | GGUUGGUAAUACCAACUUGG |
encoded miRNA: | MIR37 |
Precursor location: | 2339 - 2553 (negative strand) |
precursor length: | 215 (69 basepairs) |
MIR position: | 196 - 215 (2339 - 2358) |
MIR length: | 20 (16 paired bases) |
miRNA location TIGR v3: | chr3:2198889<2199103 |
miRNA location TIGR v5: | chr3:2198889<2199103 |
Folding energy: | -56.49 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCAGCUUAGG UAUCAAUCUA AGCCAACGCA UACAUUUGGC GAGGAAUCGA AAGUAGCUAU 60 ((((-((-(( (((((((((( ((((((-((( (----((((< <<____>>>, ,<<<<<<<<< AUUAGUAGAA UAUAUCAAAG UUAUCUAUUA CUCUACACUG UACGUAUUGU CUAAAAUUAG 120 ,,,,[[[[[- [[________ ________]] -]]]]],,,, ,,,,,,,[[[ -[[[[[[[-- AUCAUAUGAU UAUUUCAUGC UGAGAAUUUU AUACAAUGGC UGCUAUUACG UACCCCAAUA 180 -[[[[[[[[_ ____]]]]]- ]]]-]]]]]] ]-]]]>>>>> >>>>,,,,,, ,,,,))))-- ***** ********** ***** UCAUGCUUGU GCUUGGGUUG GUAAUACCAA CUUGG 215 --)))))))- )))))))))) ---))))))) -))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3264_6297-6563_248-267
- gnl|BL_ORD_ID|3264_6297+6563_1-20
- gnl|BL_ORD_ID|2199_136537-136803_248-267
- gnl|BL_ORD_ID|2199_136537+136803_1-20