IGR sequence: | igr5553#chr1#x1=25868910#l=5170 |
---|---|
Mature miRNA sequence: | UGAAGUGUUUGGGGGAACUCCCGAU |
encoded miRNA: | MIR34b |
Precursor location: | 866 - 954 (negative strand) |
precursor length: | 89 (31 basepairs) |
MIR position: | 65 - 89 (866 - 890) |
MIR length: | 25 (20 paired bases) |
miRNA location TIGR v3: | chr1:25869775<25869863 |
miRNA location TIGR v5: | chr1:26273647<26273735 |
Folding energy: | -40.80 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCUAGAGUUC UCCUGAACAC UUCAUUGGAA AUUUGUUAUU CAGUAAGCUA ACAGUUAAUU 60 ((--(((((( (((--((((( ((((-((((( --((((((__ ________)) ))))----)) ****** ********** ********* CCACUGAAGU GUUUGGGGGA ACUCCCGAU 89 )))-)))))) )))--))))) ))))--)):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2328_172107+172184_1-25
- gnl|BL_ORD_ID|2328_172107+172326_1-25
- gnl|BL_ORD_ID|2328_172107-172184_54-78
- gnl|BL_ORD_ID|2328_172107-172327_197-221
- gnl|BL_ORD_ID|2328_172250+172326_1-25
- gnl|BL_ORD_ID|2328_172250-172327_54-78
- gnl|BL_ORD_ID|2319_11703+11780_1-25
- gnl|BL_ORD_ID|2319_11703+11922_1-25
- gnl|BL_ORD_ID|2319_11703-11780_54-78
- gnl|BL_ORD_ID|2319_11703-11923_197-221
- gnl|BL_ORD_ID|2319_11846+11922_1-25
- gnl|BL_ORD_ID|2319_11846-11923_54-78