IGR sequence: | igr5553#chr1#x1=25868910#l=5170 |
---|---|
Mature miRNA sequence: | AUCGGGAGUUCCCCCAAACACUUCA |
encoded miRNA: | MIR34a |
Precursor location: | 866 - 954 (positive strand) |
precursor length: | 89 (30 basepairs) |
MIR position: | 1 - 25 (866 - 890) |
MIR length: | 25 (20 paired bases) |
miRNA location TIGR v3: | chr1:25869775>25869863 |
miRNA location TIGR v5: | chr1:26273647>26273735 |
Folding energy: | -33.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster010 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** AUCGGGAGUU CCCCCAAACA CUUCAGUGGA AUUAACUGUU AGCUUACUGA AUAACAAAUU 60 :((-(((((( (-((--(((( (((((-(((( (-----(((( (_________ _)))))---) UCCAAUGAAG UGUUCAGGAG AACUCUAGA 89 ))))-))))) ))))--))-) ))))))-))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At1g50030.1 | 68408.m05142 Target of Rapamycin (TOR) protein (pTOR) | 4 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2328_172107+172184_1-25
- gnl|BL_ORD_ID|2328_172107+172326_1-25
- gnl|BL_ORD_ID|2328_172107-172184_54-78
- gnl|BL_ORD_ID|2328_172107-172327_197-221
- gnl|BL_ORD_ID|2328_172250+172326_1-25
- gnl|BL_ORD_ID|2328_172250-172327_54-78
- gnl|BL_ORD_ID|2319_11703+11780_1-25
- gnl|BL_ORD_ID|2319_11703+11922_1-25
- gnl|BL_ORD_ID|2319_11703-11780_54-78
- gnl|BL_ORD_ID|2319_11703-11923_197-221
- gnl|BL_ORD_ID|2319_11846+11922_1-25
- gnl|BL_ORD_ID|2319_11846-11923_54-78