IGR sequence: | igr5553#chr1#x1=25868910#l=5170 |
---|---|
Mature miRNA sequence: | UGAAGUGUUUGGGGGAACUCC |
encoded miRNA: | MIR64a |
Precursor location: | 3667 - 3742 (negative strand) |
precursor length: | 76 (31 basepairs) |
MIR position: | 56 - 76 (3667 - 3687) |
MIR length: | 21 (18 paired bases) |
miRNA location TIGR v3: | chr1:25872576<25872651 |
miRNA location TIGR v5: | chr1:26276448<26276523 |
Folding energy: | -39.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster030 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
***** GAGUUCCUCU GAGCACUUCA UUGGAGAUAC AAUUUUUUAU AAAAUAGUUU UCUACUGAAG 60 (((((((((- -((((((((( -((((((-(( -(((((____ )))))-)))) ))))-))))) ********** ****** UGUUUGGGGG AACUCC 76 ))))--)))) ))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At5g43780.1 | 68412.m04828 ATP sulfurylase precursor (gb|AAD26634.1) | 2 | 2 |
Rice homologs
- gnl|BL_ORD_ID|2693_32082-32203_102-122
- gnl|BL_ORD_ID|2693_32082+32203_1-21
- gnl|BL_ORD_ID|2437_51021-51142_102-122
- gnl|BL_ORD_ID|2437_51021+51142_1-21