IGR sequence: | igr5429#chr5#x1=25893315#l=6924 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGA |
encoded miRNA: | MIR73x |
Precursor location: | 5480 - 5644 (negative strand) |
precursor length: | 165 (45 basepairs) |
MIR position: | 146 - 165 (5480 - 5499) |
MIR length: | 20 (20 paired bases) |
miRNA location TIGR v3: | chr5:25898794<25898958 |
miRNA location TIGR v5: | chr5:26307852<26308016 |
Folding energy: | -36.96 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUGUUUCAC AAUAUAAGUU GUUUUCAAAU UUCUAUUAUA UAUUAUUUUA AUGUUUUAUA 60 (((((((((( (((((((((( (((((,,,,, ,,,,,,,,<< <<--<<____ __>>-->>>> AUUAUUUCUA UUAUGCAGUG UCUUUUAUGA UUGGUUAAAC UUUUUAAAAA UAAAUAUUCU 120 ,,,,,,,,,, ,<<<<<<<-- -----<<<-- ----<<<<__ ___>>>>--- --->>>---- ***** ********** ***** UAAUCUGCGU GCUUUUAGCU AAAACAACUU AUAUUGUGAA ACGGA 165 ---->>>>>> >,,,,,,,,, )))))))))) )))))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3545_40087-40225_120-139
- gnl|BL_ORD_ID|3545_40087+40225_1-20
- gnl|BL_ORD_ID|1979_168198+168339_1-20
- gnl|BL_ORD_ID|1773_120460+120596_1-20
- gnl|BL_ORD_ID|1773_120460-120596_118-137
- gnl|BL_ORD_ID|1700_695-1012_299-318
- gnl|BL_ORD_ID|1463_10107-10245_120-139
- gnl|BL_ORD_ID|1463_10107+10245_1-20
- gnl|BL_ORD_ID|606_1053+1189_1-20
- gnl|BL_ORD_ID|606_1053-1189_118-137
- gnl|BL_ORD_ID|592_68960-69277_299-318
- gnl|BL_ORD_ID|367_75240-75378_120-139
- gnl|BL_ORD_ID|367_75240+75378_1-20
- gnl|BL_ORD_ID|353_38045-38154_91-110
- gnl|BL_ORD_ID|353_38045+38154_1-20
- gnl|BL_ORD_ID|317_59012+59150_1-20
- gnl|BL_ORD_ID|317_59012-59150_120-139
- gnl|BL_ORD_ID|310_22199+22308_1-20
- gnl|BL_ORD_ID|310_22199-22308_91-110