IGR sequence: | igr5429#chr5#x1=25893315#l=6924 |
---|---|
Mature miRNA sequence: | UUCCGUUUCACAAUAUAAGU |
encoded miRNA: | MIR33 |
Precursor location: | 5479 - 5645 (positive strand) |
precursor length: | 167 (40 basepairs) |
MIR position: | 1 - 20 (5479 - 5498) |
MIR length: | 20 (16 paired bases) |
miRNA location TIGR v3: | chr5:25898793>25898959 |
miRNA location TIGR v5: | chr5:26307851>26308017 |
Folding energy: | -38.82 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UUCCGUUUCA CAAUAUAAGU UGUUUUAGCU AAAAGCACGC AGAUUAAGAA UAUUUAUUUU 60 ::::(((((( (((((((((( ((((((,<<_ ____>>,,<< <<,[[[[[[[ [____]]]]] UAAAAAGUUU AACCAAUCAU AAAAGACACU GCAUAAUAGA AAUAAUUAUA AAACAUUAAA 120 ]]],,,[[[[ __________ ___]]]],>> >>,,,,,,,, ,,,,,,,,,, ,,,,,,,,,, AUAAUAUAUA AUAGAAAUUU GAAAACAACU UAUAUUGUGA AACAAAA 167 ,,,,,,,,,, ,,,,,,,,,, ,))))))))) )))))))))) )))::::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1340_104147-104288_123-142
- gnl|BL_ORD_ID|1340_104147+104289_1-20
- gnl|BL_ORD_ID|585_17790+17931_1-20
- gnl|BL_ORD_ID|585_17790-17929_121-140