IGR sequence: | igr1510#chr4#x1=8052761#l=1850 |
---|---|
Mature miRNA sequence: | UUUUGUUCCAAAAAUACCAUCAC |
encoded miRNA: | MIR19 |
Precursor location: | 1367 - 1595 (negative strand) |
precursor length: | 229 (53 basepairs) |
MIR position: | 1 - 23 (1573 - 1595) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr4:8054127<8054355 |
miRNA location TIGR v5: | chr4:9089133<9089361 |
Folding energy: | -42.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** UUUUGUUCCA AAAAUACCAU CACUAUGUUU CUUUUUCAAA AAUAAAACUA UUUUUUUUUC 60 :(((((((-( (((((((((( -((((((--- ((((((,,,, ,,,,,,,,<< <<<<<_____ UGAAAAUACC ACAAAACUAA AACUAAAUUU UAAGUAACUA AAUAUAAACC CUAAAAGAUA 120 _>>>>>>>,, ,,,,,,,,,, ,,,,,,,,,, ,,,,,,,,,, ,,<<<<<<<< <<<,,,[[__ AAUCCAAAAU ACUAAACCUA AACCCCAACU AUUAAAUUAG AAAGUCUUAA AAAUCAUUCU 180 __]],,,,,, ,,,,,,,,,, ,,,,,,,,[[ [______]]] ,,,,,,,,,, ,,,,,,,,,> AGGGUUUGUA GCAUAAAAAG UUUGUAGUAA UGGUAUUUUU AGAACAAAA 229 >>>>>>>>>> ,,,,)))))) --))))))-) )))))))))) -))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3144_9024-9154_1-23
- gnl|BL_ORD_ID|3144_9024+9154_109-131