IGR sequence: | igr1510#chr4#x1=8052761#l=1850 |
---|---|
Mature miRNA sequence: | UUUGUUCCAAAAAUACCAUCAC |
encoded miRNA: | MIR19a |
Precursor location: | 1368 - 1594 (negative strand) |
precursor length: | 227 (52 basepairs) |
MIR position: | 1 - 22 (1573 - 1594) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr4:8054128<8054354 |
miRNA location TIGR v5: | chr4:9089134<9089360 |
Folding energy: | -41.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** UUUGUUCCAA AAAUACCAUC ACUAUGUUUC UUUUUCAAAA AUAAAACUAU UUUUUUUUCU 60 :((((((-(( (((((((((- ((((((---( (((((,,,,, ,,,,,,,<<< <<<<______ GAAAAUACCA CAAAACUAAA ACUAAAUUUU AAGUAACUAA AUAUAAACCC UAAAAGAUAA 120 >>>>>>>,,, ,,,,,,,,,, ,,,,,,,,,, ,,,,,,,,,, ,<<<<<<<<< <<,,,[[___ AUCCAAAAUA CUAAACCUAA ACCCCAACUA UUAAAUUAGA AAGUCUUAAA AAUCAUUCUA 180 _]],,,,,,, ,,,,,,,,,, ,,,,,,,[[[ ______]]], ,,,,,,,,,, ,,,,,,,,>> GGGUUUGUAG CAUAAAAAGU UUGUAGUAAU GGUAUUUUUA GAACAAA 227 >>>>>>>>>, ,,,))))))- -))))))-)) )))))))))- )))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1408_98386-98519_1-22
- gnl|BL_ORD_ID|1408_98386+98519_113-134
- gnl|BL_ORD_ID|510_60640+60767_107-128
- gnl|BL_ORD_ID|510_60639-60767_1-22