IGR sequence: | igr493#chr4#x1=2618859#l=6354 |
---|---|
Mature miRNA sequence: | CAUCAUUGAGUGCAGCGUUGAUG |
encoded miRNA: | MIR9 |
Precursor location: | 6098 - 6188 (positive strand) |
precursor length: | 91 (38 basepairs) |
MIR position: | 1 - 23 (6098 - 6120) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr4:2624956>2625046 |
miRNA location TIGR v5: | chr4:2625956>2626046 |
Folding energy: | -37.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster016 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** CAUCAUUGAG UGCAGCGUUG AUGUAAUUUC GUUUUGUUUU UCAUUGUUGA AUGGAUUAAA 60 (((-(((((( (((((((((( -(((((-((( -(((((---( (((((____) )))))-)))) AGAAUUUAUA CCAGCGUUGC GCUCAAUUAU G 91 ))))-))))) -))))))))) )))))))-)) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g29130.1 | 68409.m03206 laccase (diphenol oxidase), putative | 3 | 1 |
Rice homologs
- gnl|BL_ORD_ID|943_4860+4957_1-23
- gnl|BL_ORD_ID|943_4860-4957_76-98
- gnl|BL_ORD_ID|131_37991+38088_1-23
- gnl|BL_ORD_ID|131_37991-38088_76-98