IGR sequence: | igr4923#chr1#x1=22943885#l=3824 |
---|---|
Mature miRNA sequence: | CCUGCCAAAGGAGAGUUGCCCUG |
encoded miRNA: | MIR24a |
Precursor location: | 1296 - 1410 (negative strand) |
precursor length: | 115 (39 basepairs) |
MIR position: | 93 - 115 (1296 - 1318) |
MIR length: | 23 (21 paired bases) |
miRNA location TIGR v3: | chr1:22945180<22945294 |
miRNA location TIGR v5: | chr1:23349052<23349166 |
Folding energy: | -47.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UAGGGCGCCU CUCCAUUGGC AGGUCCUUUA CUUCCAAAUA UACACAUACA UAUAUGAAUA 60 (((((((-(( ((((-((((( (((((-(((( ,,,,,,,<<< <<________ >>>>><<-<< ******** ********** ***** UCGAAAAUUU CCGAUGAUCG AUUUAUAAAU GACCUGCCAA AGGAGAGUUG CCCUG 115 <<<_______ _>>>>>->>, ,,,,,))))- )))))))))) -))))))-)) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|710_89767+90031_1-23
- gnl|BL_ORD_ID|302_34685+34780_1-23
- gnl|BL_ORD_ID|302_34685-34780_74-96
- gnl|BL_ORD_ID|123_113296-113388_71-93
- gnl|BL_ORD_ID|123_113296+113388_1-23