IGR sequence: | igr4923#chr1#x1=22943885#l=3824 |
---|---|
Mature miRNA sequence: | CAGGGCAACUCUCCUUUGGCAGG |
encoded miRNA: | MIR24 |
Precursor location: | 1296 - 1409 (positive strand) |
precursor length: | 114 (41 basepairs) |
MIR position: | 1 - 23 (1296 - 1318) |
MIR length: | 23 (19 paired bases) |
miRNA location TIGR v3: | chr1:22945180>22945293 |
miRNA location TIGR v5: | chr1:23349052>23349165 |
Folding energy: | -50.90 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** CAGGGCAACU CUCCUUUGGC AGGUCAUUUA UAAAUCGAUC AUCGGAAAUU UUCGAUAUUC 60 :(((((--(( ((((-((((( (((((-(((( (,,,,,,,,, <<<<<<____ >>>>>>,<<< AUAUAUGUAU GUGUAUAUUU GGAAGUAAAG GACCUGCCAA UGGAGAGGCG CCCU 114 <-<<<<<___ ___>>>>>-> >>>,)))))- )))))))))) -))))))--) ))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|710_89767+90031_1-23
- gnl|BL_ORD_ID|302_34685+34780_1-23
- gnl|BL_ORD_ID|302_34685-34780_74-96
- gnl|BL_ORD_ID|123_113296-113388_71-93
- gnl|BL_ORD_ID|123_113296+113388_1-23