IGR sequence: | igr444#chr2#x1=2195423#l=2723 |
---|---|
Mature miRNA sequence: | CUCCCUCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR89n |
Precursor location: | 841 - 1203 (positive strand) |
precursor length: | 363 (94 basepairs) |
MIR position: | 339 - 363 (1179 - 1203) |
MIR length: | 25 (23 paired bases) |
miRNA location TIGR v3: | chr2:2196263>2196625 |
miRNA location TIGR v5: | chr2:2197263>2197625 |
Folding energy: | -70.35 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AAUUUAUAUU AUAAAAUGGA GGGAGUAGGU UUUAAUAAUA CAUAUAUAAC GCUUUUGUUA 60 (((((((((( -(-((((((( (((((((-(- -(((((((,, ,,,,,,,,,, ,,<<<<<--< AAAUGUUAAA CGUUGACUAA UUUAUUGUGU AUACAUGAUA UUUGGAGAAU AAAUUUGUCA 120 <<<<<<<<<< -<<<<<,,,, ,,[[[--[[_ ___]]--]]] ,,,[[[[,,{ {{{---{{{{ AUUAUAAAUA CUUGUAGAUU UAAUUGACCA UUUUAACUUU GAAAGCUCAA AUUUUUUUCA 180 {{{{----{{ ____}}---- }}}}}}}}-- -}}}},,{{{ {{____}}}} },,,,,,,,, UUCCUAAUUU AAAAGUUUAC UAAAAGUUUC AAUUUUUUCA ACAUUUUUUC AAAAAAAGAU 240 ]]]],,,,,, ,,,,,,,,,, ,,,,,,,,>> >>>->>>--> >>>>>>>--> >>>>,,,,,, AUUAUACCAC AACUAUUACG AGUAACUAAC CUACUUGCAU GACCAUUUCU UUACUCAUUU 300 ,,,,,,,,,, ,,{{{{{{{{ -{-{{{____ __________ __________ __________ ** ********** ********** UGUUUCCGUA GUAGAAAUAA UUUUUUGUUA GUUCGAUACU CCCUCCGUUU CACAAUAUAA 360 _}}}-}}}}} }}}},,,,,, ,,,,)))))) )--)--)))) )))))))))) -)-))))))) *** GUU 363 )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|62_48372+48521_126-150