IGR sequence: | igr4444#chr3#x1=20692045#l=9635 |
---|---|
Mature miRNA sequence: | AGGAUCAAUGCGAUCCCUUUGGAU |
encoded miRNA: | MIR11 |
Precursor location: | 7607 - 7748 (negative strand) |
precursor length: | 142 (47 basepairs) |
MIR position: | 119 - 142 (7607 - 7630) |
MIR length: | 24 (21 paired bases) |
miRNA location TIGR v3: | chr3:20699651<20699792 |
miRNA location TIGR v5: | chr3:20702635<20702776 |
Folding energy: | -47.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster007 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AUCCAAAGAG AUCGCAUGAU CCGGAAAAGU AAGCAAAAUG UUUGGAAUUU GUUUUUCUUC 60 ((((((((-( (((((((((( ((-------( ((((,,,,,, ,,,,,,,,<< <<<<<<-<<< ** CAUCUUUCGA UUGAGAAGGA AAAAAAAAAC AAUUAUUGGG GAAUAAAUCA GCUUAAUUAG 120 <-<<<<____ __>>>>->>> >--->>>>>> >><<<<<___ _>>>>>,,,, )))))----) ********** ********** ** GAUCAAUGCG AUCCCUUUGG AU 142 ))))-))))) )))-)))))) ))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At4g18600.1 | 68411.m02515 gene 11-1 protein - like | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|517_37281-37376_73-96
- gnl|BL_ORD_ID|517_37281+37376_1-24
- gnl|BL_ORD_ID|464_91815-91910_73-96
- gnl|BL_ORD_ID|464_91815+91910_1-24