IGR sequence: | igr4147#chr1#x1=19730787#l=4121 |
---|---|
Mature miRNA sequence: | ACUUAUAUUAUGAAACAGAGGGA |
encoded miRNA: | MIR25g |
Precursor location: | 390 - 604 (negative strand) |
precursor length: | 215 (58 basepairs) |
MIR position: | 193 - 215 (390 - 412) |
MIR length: | 23 (20 paired bases) |
miRNA location TIGR v3: | chr1:19718611<19718825 chr1:19731176<19731390 |
miRNA location TIGR v5: | chr1:20122483<20122697 chr1:20135048<20135262 |
Folding energy: | -31.25 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCAUCUGUU UUACAAUAUA AAUUGUUUUA AAUAAAAACA CGCAAAUUAA AAAUAUUUAC 60 (((-(((((( (((-(((((( (-(((((((- (((((,,,,, ,<<<<<<<<, ,,,[[[[[[- UUUUAAAAAA UUCUACUAAU CACAAAAGAG ACUACAUAAC AUAAAUAAUC AUAAAAUAUU 120 ---------- [[[[______ ______]]]] ---------- -]]]]]],,, ,,,,,[[[[[ AAAAUAAUAU AUAAUUUGUA UAGAAACUUG AAAACAACUU AUAUAGUAAA ACAAAAAAAU 180 [___]]]]]] ,>>>>>>>>, ,,,,,,,,,, ,,,,,,[[[_ ____]]],,, ,,,,,,,,,) ******** ********** ***** UGUUCCAAAA CAACUUAUAU UAUGAAACAG AGGGA 215 ))))--)))) )))-)))))) )-)))))))) )-)))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2115_140946+141136_1-23
- gnl|BL_ORD_ID|2115_140946-141136_169-191