IGR sequence: | igr4121#chr2#x1=19115407#l=13764 |
---|---|
Mature miRNA sequence: | UCGGACCAGGCUUCAUUCCCC |
encoded miRNA: | MIR70e |
Precursor location: | 9177 - 9312 (positive strand) |
precursor length: | 136 (49 basepairs) |
MIR position: | 116 - 136 (9292 - 9312) |
MIR length: | 21 (16 paired bases) |
miRNA location TIGR v3: | chr2:19124583>19124718 |
miRNA location TIGR v5: | chr2:19183196>19183331 |
Folding energy: | -56.40 |
BLAST hit against RFAM Atha miRNAs: | ath-MIR166a |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
GGGGACUGUU GUCUGGCUCG AGGACUCUGG CUCGCUCUAU UCAUGUUGGA UCUCUUUCGA 60 (((((-((-- ((((((--(( (((((-(((( ---((((((- (((<<<<<<< <<______>> ***** UCUAACAAUC GAAUUGAACC UUCAGAUUUC AGAUUUGAUU AGGGUUUUAG CGUCUUCGGA 120 >>>>>>>,,, <<<<<<<___ _>>>>-->>> ,,,,,)))-) )))))-)))) -)))))))-- ********** ****** CCAGGCUUCA UUCCCC 136 ))))))--)) -)))))

Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1466_100979-101071_1-21
- gnl|BL_ORD_ID|1466_100979+101071_73-93
- gnl|BL_ORD_ID|1425_155477+155569_73-93
- gnl|BL_ORD_ID|1425_155477-155569_1-21
- gnl|BL_ORD_ID|830_136567-136643_1-21
- gnl|BL_ORD_ID|830_136567+136643_57-77
- gnl|BL_ORD_ID|31_95866+95976_91-111