IGR sequence: | igr4079#chr2#x1=18941708#l=2762 |
---|---|
Mature miRNA sequence: | AGGAGCUCCCUUCAAUCCAA |
encoded miRNA: | MIR88a |
Precursor location: | 1395 - 1599 (negative strand) |
precursor length: | 205 (71 basepairs) |
MIR position: | 1 - 20 (1580 - 1599) |
MIR length: | 20 (18 paired bases) |
miRNA location TIGR v3: | chr2:18943102<18943306 |
miRNA location TIGR v5: | chr2:19001715<19001919 |
Folding energy: | -86.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** AGGAGCUCCC UUCAAUCCAA ACGAAGAGAA GAGAAUGAUA UGUAGAGAAA GAGGGAGAAU 60 (((((((((( (((--((((( ((((((((-- ((-((-(((- ((--(((--( ((((-((((( CUAAGAGGUC GUGCAAUCCC CUUAAAGUGU GCUUUCUUCA AGCUUUUAAC ACCGCGCACU 120 (((((((-(( (((---(((- (----((((( ((________ __________ ___))))))) CUCUAUGAGG AAGACAUGAA CUCUUAGAUU CUGCAUUUUA GUUCCUCAAA UCUUGUCCUC 180 ------)-)) )---)))))- )))))))))) ))-)-))))- -)))--))-) ))))-))))) UUCGUUUUGG AGGAAGGGAG CUCCU 205 ))))-))))) )-)))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|479_23793-23963_1-20
- gnl|BL_ORD_ID|479_23793+23963_152-171