IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | AAUAGUUACUCCCUCCGUUUCAC |
encoded miRNA: | MIR23f |
Precursor location: | 3099 - 3331 (negative strand) |
precursor length: | 233 (75 basepairs) |
MIR position: | 1 - 23 (3309 - 3331) |
MIR length: | 23 (18 paired bases) |
miRNA location TIGR v3: | chr1:18835555<18835787 |
miRNA location TIGR v5: | chr1:19239427<19239659 |
Folding energy: | -58.84 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** *** AAUAGUUACU CCCUCCGUUU CACGAUAUAA AUUAUUUUAG CUAAAAGCAC GUAAAUUAAA 60 ::::(-(((( (((((((((( (((((((((( -((-(((((( (((((,,,,, <<<<<<<<,, AAUAUUUACU UUUAAAAAGU UCAGCCAAUU AUAAAAGAAA CUGUAGAAUA UAAAUAAUCA 120 ,,[[[[[[-[ [[[[---[[[ [[________ ______]-]] ]]-]]]]]-- ]]]]]],,,, UAAAGUAUUA AAGUAAUAUA UAAUUUGCAU AGAAACUUGA AAACAACUUA UAUUGUGAAA 180 ,,,,[[[[[[ ___]]]]]], >>>>>>>>,, ,,,,,,[[[- --[[[[____ __]]]]---- CAAAAAAUUU GGUCUAAAAC AACUUAUAUU GUGAAACGGA GGGAGUGCCA AAU 233 ]]],,,,))) ))-))))))- ))-))))))) )))))))))) )))))))-): :::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1117_34893+35057_143-165
- gnl|BL_ORD_ID|1117_34892-35057_1-23