IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UUAUAUCGUGAAACGGAGGGAGUAA |
encoded miRNA: | MIR23j |
Precursor location: | 3106 - 3326 (positive strand) |
precursor length: | 221 (73 basepairs) |
MIR position: | 197 - 221 (3302 - 3326) |
MIR length: | 25 (22 paired bases) |
miRNA location TIGR v3: | chr1:18835562>18835782 |
miRNA location TIGR v5: | chr1:19239434>19239654 |
Folding energy: | -62.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
ACUCCCUCCG UUUCACAAUA UAAGUUGUUU UAGACCAAAU UUUUUGUUUC ACAAUAUAAG 60 (((((((((( ((((((-((( (((((((((( (((,,,,,,, ,,<<<<---- <<<<<____> UUGUUUUCAA GUUUCUAUGC AAAUUAUAUA UUACUUUAAU ACUUUAUGAU UAUUUAUAUU 120 >>>>--->>> >,,,,<<<<- <<<<<<-<<< <<<<<<<,,, ,,,,[[[[[_ ___]]]]],, CUACAGUUUC UUUUAUAAUU GGCUGAACUU UUUAAAAGUA AAUAUUUUUA AUUUACGUGC 180 ,,,[[[[[-- [[____]]-- ]]]]],,,,, ,,,,>>>>>- >>>>>--->> >>>>->>>>, **** ********** ********** * UUUUAGCUAA AAUAAUUUAU AUCGUGAAAC GGAGGGAGUA A 221 ,,,,,,)))) )))))))))) ))-))))))) ))))))))): :
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3224_110023-110178_1-25
- gnl|BL_ORD_ID|3224_110024+110178_131-155
- gnl|BL_ORD_ID|2997_10518-10646_1-25
- gnl|BL_ORD_ID|2997_10518+10646_105-129
- gnl|BL_ORD_ID|2629_149152+149278_103-127
- gnl|BL_ORD_ID|2629_149151-149278_1-25
- gnl|BL_ORD_ID|2038_109976-110131_1-25
- gnl|BL_ORD_ID|2038_109976+110131_132-156
- gnl|BL_ORD_ID|1911_34429+34583_131-155
- gnl|BL_ORD_ID|1911_34428-34583_1-25
- gnl|BL_ORD_ID|1771_14848-14981_1-25
- gnl|BL_ORD_ID|1771_14849+14981_109-133
- gnl|BL_ORD_ID|1660_43644-43732_1-25
- gnl|BL_ORD_ID|1660_43645+43732_64-88
- gnl|BL_ORD_ID|1396_51601+51755_131-155
- gnl|BL_ORD_ID|1396_51600-51755_1-25
- gnl|BL_ORD_ID|1162_61260-61412_1-25
- gnl|BL_ORD_ID|1162_61260+61412_129-153
- gnl|BL_ORD_ID|1006_23794-23921_1-25
- gnl|BL_ORD_ID|1006_23795+23921_103-127
- gnl|BL_ORD_ID|933_86800+86954_131-155
- gnl|BL_ORD_ID|933_86800-86954_1-25
- gnl|BL_ORD_ID|409_93846-93984_1-25
- gnl|BL_ORD_ID|409_93846+93984_115-139
- gnl|BL_ORD_ID|343_68348+68503_132-156
- gnl|BL_ORD_ID|343_68348-68503_1-25
- gnl|BL_ORD_ID|142_82400-82554_1-25
- gnl|BL_ORD_ID|142_82400+82554_131-155
- gnl|BL_ORD_ID|2223_13506+13660_131-155