IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UUAUAUCGUGAAACGGAGGGAGU |
encoded miRNA: | MIR23 |
Precursor location: | 3106 - 3324 (positive strand) |
precursor length: | 219 (73 basepairs) |
MIR position: | 197 - 219 (3302 - 3324) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr1:18835562>18835780 |
miRNA location TIGR v5: | chr1:19239434>19239652 |
Folding energy: | -62.00 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
ACUCCCUCCG UUUCACAAUA UAAGUUGUUU UAGACCAAAU UUUUUGUUUC ACAAUAUAAG 60 (((((((((( ((((((-((( (((((((((( (((,,,,,,, ,,<<<<---- <<<<<____> UUGUUUUCAA GUUUCUAUGC AAAUUAUAUA UUACUUUAAU ACUUUAUGAU UAUUUAUAUU 120 >>>>--->>> >,,,,<<<<- <<<<<<-<<< <<<<<<<,,, ,,,,[[[[[_ ___]]]]],, CUACAGUUUC UUUUAUAAUU GGCUGAACUU UUUAAAAGUA AAUAUUUUUA AUUUACGUGC 180 ,,,[[[[[-- [[____]]-- ]]]]],,,,, ,,,,>>>>>- >>>>>--->> >>>>->>>>, **** ********** ********* UUUUAGCUAA AAUAAUUUAU AUCGUGAAAC GGAGGGAGU 219 ,,,,,,)))) )))))))))) ))-))))))) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3416_15340-15475_1-23
- gnl|BL_ORD_ID|3416_15340+15475_114-136
- gnl|BL_ORD_ID|494_37829+37977_127-149
- gnl|BL_ORD_ID|494_37829-37977_1-23
- gnl|BL_ORD_ID|491_132717+132865_127-149
- gnl|BL_ORD_ID|491_132717-132865_1-23