IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UACUCCCUCCGUUUCACGAUAUAAA |
encoded miRNA: | MIR23b |
Precursor location: | 3105 - 3325 (negative strand) |
precursor length: | 221 (74 basepairs) |
MIR position: | 1 - 25 (3301 - 3325) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr1:18835561<18835781 |
miRNA location TIGR v5: | chr1:19239433<19239653 |
Folding energy: | -57.54 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** UACUCCCUCC GUUUCACGAU AUAAAUUAUU UUAGCUAAAA GCACGUAAAU UAAAAAUAUU 60 (((((((((( (((((((((( ((((-((-(( (((((((((, ,,,,<<<<<< <<,,,,[[[[ UACUUUUAAA AAGUUCAGCC AAUUAUAAAA GAAACUGUAG AAUAUAAAUA AUCAUAAAGU 120 [[-[[[[[-- -[[[[[____ __________ ]-]]]]-]]] ]]--]]]]]] ,,,,,,,,[[ AUUAAAGUAA UAUAUAAUUU GCAUAGAAAC UUGAAAACAA CUUAUAUUGU GAAACAAAAA 180 [[[[___]]] ]]],>>>>>> >>,,,,,,,, [[[---[[[[ ______]]]] ----]]],,, AUUUGGUCUA AAACAACUUA UAUUGUGAAA CGGAGGGAGU G 221 ,)))))-))) )))-))-))) )))))))))) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1277_62339-62492_1-25
- gnl|BL_ORD_ID|1060_13159-13312_1-25