IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UUUAUAUCGUGAAACGGAGGGAGUA |
encoded miRNA: | MIR23h |
Precursor location: | 3106 - 3325 (positive strand) |
precursor length: | 220 (73 basepairs) |
MIR position: | 196 - 220 (3301 - 3325) |
MIR length: | 25 (23 paired bases) |
miRNA location TIGR v3: | chr1:18835562>18835781 |
miRNA location TIGR v5: | chr1:19239434>19239653 |
Folding energy: | -62.70 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
ACUCCCUCCG UUUCACAAUA UAAGUUGUUU UAGACCAAAU UUUUUGUUUC ACAAUAUAAG 60 (((((((((( ((((((-((( (((((((((( (((,,,,,,, ,,<<<<---- <<<<<____> UUGUUUUCAA GUUUCUAUGC AAAUUAUAUA UUACUUUAAU ACUUUAUGAU UAUUUAUAUU 120 >>>>--->>> >,,,,<<<<- <<<<<<-<<< <<<<<<<,,, ,,,,[[[[[_ ___]]]]],, CUACAGUUUC UUUUAUAAUU GGCUGAACUU UUUAAAAGUA AAUAUUUUUA AUUUACGUGC 180 ,,,[[[[[-- [[____]]-- ]]]]],,,,, ,,,,>>>>>- >>>>>--->> >>>>->>>>, ***** ********** ********** UUUUAGCUAA AAUAAUUUAU AUCGUGAAAC GGAGGGAGUA 220 ,,,,,,)))) )))))))))) ))-))))))) ))))))))):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1277_62339-62492_1-25
- gnl|BL_ORD_ID|1060_13159-13312_1-25