IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | ACUCCCUCCGUUUCACGAUAUAAA |
encoded miRNA: | MIR23a |
Precursor location: | 3106 - 3324 (negative strand) |
precursor length: | 219 (73 basepairs) |
MIR position: | 1 - 24 (3301 - 3324) |
MIR length: | 24 (23 paired bases) |
miRNA location TIGR v3: | chr1:18835562<18835780 |
miRNA location TIGR v5: | chr1:19239434<19239652 |
Folding energy: | -56.54 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** ACUCCCUCCG UUUCACGAUA UAAAUUAUUU UAGCUAAAAG CACGUAAAUU AAAAAUAUUU 60 (((((((((( (((((((((( (((-((-((( ((((((((,, ,,,<<<<<<< <,,,,[[[[[ ACUUUUAAAA AGUUCAGCCA AUUAUAAAAG AAACUGUAGA AUAUAAAUAA UCAUAAAGUA 120 [-[[[[[--- [[[[[_____ _________] -]]]]-]]]] ]--]]]]]], ,,,,,,,[[[ UUAAAGUAAU AUAUAAUUUG CAUAGAAACU UGAAAACAAC UUAUAUUGUG AAACAAAAAA 180 [[[___]]]] ]],>>>>>>> >,,,,,,,,[ [[---[[[[_ _____]]]]- ---]]],,,, UUUGGUCUAA AACAACUUAU AUUGUGAAAC GGAGGGAGU 219 )))))-)))) ))-))-)))) )))))))))) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|122_84139-84266_1-24
- gnl|BL_ORD_ID|122_84139+84266_105-128
- gnl|BL_ORD_ID|106_79187+79314_105-128
- gnl|BL_ORD_ID|106_79187-79314_1-24