IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGA |
encoded miRNA: | MIR73x |
Precursor location: | 3112 - 3318 (negative strand) |
precursor length: | 207 (67 basepairs) |
MIR position: | 188 - 207 (3112 - 3131) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835568<18835774 |
miRNA location TIGR v5: | chr1:19239440<19239646 |
Folding energy: | -41.14 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCGUUUCAC GAUAUAAAUU AUUUUAGCUA AAAGCACGUA AAUUAAAAAU AUUUACUUUU 60 (((((((((( (((((((-(( -((((((((( ((,,,,,<<< <<<<<,,,,[ [[[[[-[[[[ AAAAAGUUCA GCCAAUUAUA AAAGAAACUG UAGAAUAUAA AUAAUCAUAA AGUAUUAAAG 120 [---[[[[[_ __________ ___]-]]]]- ]]]]]--]]] ]]],,,,,,, ,[[[[[[___ UAAUAUAUAA UUUGCAUAGA AACUUGAAAA CAACUUAUAU UGUGAAACAA AAAAUUUGGU 180 ]]]]]],>>> >>>>>,,,,, ,,,[[[---[ [[[______] ]]]----]]] ,,,,)))))- *** ********** ******* CUAAAACAAC UUAUAUUGUG AAACGGA 207 ))))))-))- )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2932_34718+34816_1-20
- gnl|BL_ORD_ID|2932_34718-34816_80-99