IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR73w |
Precursor location: | 3112 - 3318 (positive strand) |
precursor length: | 207 (67 basepairs) |
MIR position: | 1 - 20 (3112 - 3131) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835568>18835774 |
miRNA location TIGR v5: | chr1:19239440>19239646 |
Folding energy: | -46.60 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UCCGUUUCAC AAUAUAAGUU GUUUUAGACC AAAUUUUUUG UUUCACAAUA UAAGUUGUUU 60 (((((((((( -((((((((( (((((((,,, ,,,,,,<<<< ----<<<<<_ ___>>>>>-- UCAAGUUUCU AUGCAAAUUA UAUAUUACUU UAAUACUUUA UGAUUAUUUA UAUUCUACAG 120 ->>>>,,,,< <<<-<<<<<< -<<<<<<<<< <,,,,,,,[[ [[[____]]] ]],,,,,[[[ UUUCUUUUAU AAUUGGCUGA ACUUUUUAAA AGUAAAUAUU UUUAAUUUAC GUGCUUUUAG 180 [[--[[____ ]]--]]]]], ,,,,,,,,>> >>>->>>>>- -->>>>>>-> >>>,,,,,,, CUAAAAUAAU UUAUAUCGUG AAACGGA 207 )))))))))) ))))))-))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2932_34718+34816_1-20
- gnl|BL_ORD_ID|2932_34718-34816_80-99