IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAG |
encoded miRNA: | MIR73t |
Precursor location: | 3111 - 3319 (negative strand) |
precursor length: | 209 (68 basepairs) |
MIR position: | 190 - 209 (3111 - 3130) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835567<18835775 |
miRNA location TIGR v5: | chr1:19239439<19239647 |
Folding energy: | -43.74 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCGUUUCA CGAUAUAAAU UAUUUUAGCU AAAAGCACGU AAAUUAAAAA UAUUUACUUU 60 (((((((((( ((((((((-( (-(((((((( (((,,,,,<< <<<<<<,,,, [[[[[[-[[[ UAAAAAGUUC AGCCAAUUAU AAAAGAAACU GUAGAAUAUA AAUAAUCAUA AAGUAUUAAA 120 [[---[[[[[ __________ ____]-]]]] -]]]]]--]] ]]]],,,,,, ,,[[[[[[__ GUAAUAUAUA AUUUGCAUAG AAACUUGAAA ACAACUUAUA UUGUGAAACA AAAAAUUUGG 180 _]]]]]],>> >>>>>>,,,, ,,,,[[[--- [[[[______ ]]]]----]] ],,,,))))) * ********** ********* UCUAAAACAA CUUAUAUUGU GAAACGGAG 209 -))))))-)) -))))))))) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2415_43922+44063_1-20
- gnl|BL_ORD_ID|2415_43922-44063_123-142
- gnl|BL_ORD_ID|1396_61736-61879_125-144
- gnl|BL_ORD_ID|1396_61736+61879_1-20
- gnl|BL_ORD_ID|1389_101274+101399_1-20
- gnl|BL_ORD_ID|1389_101274-101399_107-126