IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CUCCGUUUCACAAUAUAAGU |
encoded miRNA: | MIR73s |
Precursor location: | 3111 - 3319 (positive strand) |
precursor length: | 209 (68 basepairs) |
MIR position: | 1 - 20 (3111 - 3130) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835567>18835775 |
miRNA location TIGR v5: | chr1:19239439>19239647 |
Folding energy: | -49.20 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** CUCCGUUUCA CAAUAUAAGU UGUUUUAGAC CAAAUUUUUU GUUUCACAAU AUAAGUUGUU 60 (((((((((( (-(((((((( ((((((((,, ,,,,,,,<<< <----<<<<< ____>>>>>- UUCAAGUUUC UAUGCAAAUU AUAUAUUACU UUAAUACUUU AUGAUUAUUU AUAUUCUACA 120 -->>>>,,,, <<<<-<<<<< <-<<<<<<<< <<,,,,,,,[ [[[[____]] ]]],,,,,[[ GUUUCUUUUA UAAUUGGCUG AACUUUUUAA AAGUAAAUAU UUUUAAUUUA CGUGCUUUUA 180 [[[--[[___ _]]--]]]]] ,,,,,,,,,> >>>>->>>>> --->>>>>>- >>>>,,,,,, GCUAAAAUAA UUUAUAUCGU GAAACGGAG 209 ,))))))))) )))))))-)) )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2415_43922+44063_1-20
- gnl|BL_ORD_ID|2415_43922-44063_123-142
- gnl|BL_ORD_ID|1396_61736-61879_125-144
- gnl|BL_ORD_ID|1396_61736+61879_1-20
- gnl|BL_ORD_ID|1389_101274+101399_1-20
- gnl|BL_ORD_ID|1389_101274-101399_107-126