IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CCUCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR89v |
Precursor location: | 3110 - 3320 (positive strand) |
precursor length: | 211 (69 basepairs) |
MIR position: | 1 - 22 (3110 - 3131) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr1:18835566>18835776 |
miRNA location TIGR v5: | chr1:19239438>19239648 |
Folding energy: | -52.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** CCUCCGUUUC ACAAUAUAAG UUGUUUUAGA CCAAAUUUUU UGUUUCACAA UAUAAGUUGU 60 (((((((((( ((-((((((( (((((((((, ,,,,,,,,<< <<----<<<< <____>>>>> UUUCAAGUUU CUAUGCAAAU UAUAUAUUAC UUUAAUACUU UAUGAUUAUU UAUAUUCUAC 120 --->>>>,,, ,<<<<-<<<< <<-<<<<<<< <<<,,,,,,, [[[[[____] ]]]],,,,,[ AGUUUCUUUU AUAAUUGGCU GAACUUUUUA AAAGUAAAUA UUUUUAAUUU ACGUGCUUUU 180 [[[[--[[__ __]]--]]]] ],,,,,,,,, >>>>>->>>> >--->>>>>> ->>>>,,,,, AGCUAAAAUA AUUUAUAUCG UGAAACGGAG G 211 ,,)))))))) ))))))))-) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|353_38045-38158_93-114
- gnl|BL_ORD_ID|353_38045+38158_1-22
- gnl|BL_ORD_ID|310_22197+22310_1-22
- gnl|BL_ORD_ID|310_22197-22310_93-114
- gnl|BL_ORD_ID|3545_40087-40229_122-143
- gnl|BL_ORD_ID|3545_40087+40229_1-22