IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CUUAUAUUGUGAAACGGAGG |
encoded miRNA: | MIR89s |
Precursor location: | 3110 - 3320 (negative strand) |
precursor length: | 211 (69 basepairs) |
MIR position: | 192 - 211 (3110 - 3129) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835566<18835776 |
miRNA location TIGR v5: | chr1:19239438<19239648 |
Folding energy: | -47.04 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CCUCCGUUUC ACGAUAUAAA UUAUUUUAGC UAAAAGCACG UAAAUUAAAA AUAUUUACUU 60 (((((((((( (((((((((- ((-((((((( ((((,,,,,< <<<<<<<,,, ,[[[[[[-[[ UUAAAAAGUU CAGCCAAUUA UAAAAGAAAC UGUAGAAUAU AAAUAAUCAU AAAGUAUUAA 120 [[[---[[[[ [_________ _____]-]]] ]-]]]]]--] ]]]]],,,,, ,,,[[[[[[_ AGUAAUAUAU AAUUUGCAUA GAAACUUGAA AACAACUUAU AUUGUGAAAC AAAAAAUUUG 180 __]]]]]],> >>>>>>>,,, ,,,,,[[[-- -[[[[_____ _]]]]----] ]],,,,)))) ********* ********** * GUCUAAAACA ACUUAUAUUG UGAAACGGAG G 211 )-))))))-) )-)))))))) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2078_59423+59544_1-20
- gnl|BL_ORD_ID|2078_59423+59547_1-20
- gnl|BL_ORD_ID|2078_59423-59544_103-122
- gnl|BL_ORD_ID|252_10080-10201_103-122
- gnl|BL_ORD_ID|252_10080+10201_1-20
- gnl|BL_ORD_ID|252_10080+10204_1-20
- gnl|BL_ORD_ID|1832_67620-67720_82-101
- gnl|BL_ORD_ID|1832_67620+67720_1-20