IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | ACUUAUAUUGUGAAACGGAGGGA |
encoded miRNA: | MIR89q |
Precursor location: | 3108 - 3322 (negative strand) |
precursor length: | 215 (71 basepairs) |
MIR position: | 193 - 215 (3108 - 3130) |
MIR length: | 23 (22 paired bases) |
miRNA location TIGR v3: | chr1:18835564<18835778 |
miRNA location TIGR v5: | chr1:19239436<19239650 |
Folding energy: | -52.24 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UCCCUCCGUU UCACGAUAUA AAUUAUUUUA GCUAAAAGCA CGUAAAUUAA AAAUAUUUAC 60 (((((((((( (((((((((( (-((-((((( ((((((,,,, ,<<<<<<<<, ,,,[[[[[[- UUUUAAAAAG UUCAGCCAAU UAUAAAAGAA ACUGUAGAAU AUAAAUAAUC AUAAAGUAUU 120 [[[[[---[[ [[[_______ _______]-] ]]]-]]]]]- -]]]]]],,, ,,,,,[[[[[ AAAGUAAUAU AUAAUUUGCA UAGAAACUUG AAAACAACUU AUAUUGUGAA ACAAAAAAUU 180 [___]]]]]] ,>>>>>>>>, ,,,,,,,[[[ ---[[[[___ ___]]]]--- -]]],,,,)) ******** ********** ***** UGGUCUAAAA CAACUUAUAU UGUGAAACGG AGGGA 215 )))-)))))) -))-)))))) )))))))))) )))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3328_82110-82257_126-148
- gnl|BL_ORD_ID|3328_82110+82257_1-23
- gnl|BL_ORD_ID|1974_15776-15923_126-148
- gnl|BL_ORD_ID|1974_15776+15923_1-23
- gnl|BL_ORD_ID|1588_134473-134620_126-148
- gnl|BL_ORD_ID|1588_134473+134620_1-23
- gnl|BL_ORD_ID|2196_67634+67782_1-23
- gnl|BL_ORD_ID|2196_67634-67782_127-149
- gnl|BL_ORD_ID|487_128796+128922_1-23
- gnl|BL_ORD_ID|487_128796-128922_105-127