IGR sequence: | igr1051#chr3#x1=4116016#l=6048 |
---|---|
Mature miRNA sequence: | CUUAUAUUAUGAAACGAAGGGA |
encoded miRNA: | MIR90 |
Precursor location: | 2494 - 2670 (negative strand) |
precursor length: | 177 (60 basepairs) |
MIR position: | 156 - 177 (2494 - 2515) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr3:4118509<4118685 |
miRNA location TIGR v5: | chr3:4118509<4118685 |
Folding energy: | -36.22 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UUUUUGUUUU ACAAUAUAAG UUGUUUUCAA GUUUUUAUGC AAAUUAUAUA AUAUUUUAAU 60 (((((((((( (-(((((((( (((((((--( (-------(( (,<<<<<<<< <<<<-<<<<< AAUUUAUGAU UAAUUAUAUU AUGUAGUCUC UUUUCUAAUU GGUUAAACUU UUUAAAAAUA 120 ________>> >>>-->>>>> >>>>>>>,,, ,,,,,,,,,, <<<<<<<<-- <<<<____>> ***** ********** ******* AAUGUUCUUA AUCUACGUGC UUUUAUCUAA AACAACUUAU AUUAUGAAAC GAAGGGA 177 >>->>-->>> >>>,,,,))) ------)))) )))))))))) )))-)))))) )))))::
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2990_45626-45817_171-192