IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | AACUUAUAUUGUGAAACGGAGGGAG |
encoded miRNA: | MIR89o |
Precursor location: | 3107 - 3323 (negative strand) |
precursor length: | 217 (72 basepairs) |
MIR position: | 193 - 217 (3107 - 3131) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr1:18835563<18835779 |
miRNA location TIGR v5: | chr1:19239435<19239651 |
Folding energy: | -54.84 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
CUCCCUCCGU UUCACGAUAU AAAUUAUUUU AGCUAAAAGC ACGUAAAUUA AAAAUAUUUA 60 (((((((((( (((((((((( ((-((-(((( (((((((,,, ,,<<<<<<<< ,,,,[[[[[[ CUUUUAAAAA GUUCAGCCAA UUAUAAAAGA AACUGUAGAA UAUAAAUAAU CAUAAAGUAU 120 -[[[[[---[ [[[[______ ________]- ]]]]-]]]]] --]]]]]],, ,,,,,,[[[[ UAAAGUAAUA UAUAAUUUGC AUAGAAACUU GAAAACAACU UAUAUUGUGA AACAAAAAAU 180 [[___]]]]] ],>>>>>>>> ,,,,,,,,[[ [---[[[[__ ____]]]]-- --]]],,,,) ******** ********** ******* UUGGUCUAAA ACAACUUAUA UUGUGAAACG GAGGGAG 217 ))))-))))) )-))-))))) )))))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2353_89763+89904_1-25
- gnl|BL_ORD_ID|62_48497-48646_126-150