IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CUCCCUCCGUUUCACAAUAUAAGUU |
encoded miRNA: | MIR89n |
Precursor location: | 3107 - 3323 (positive strand) |
precursor length: | 217 (72 basepairs) |
MIR position: | 1 - 25 (3107 - 3131) |
MIR length: | 25 (24 paired bases) |
miRNA location TIGR v3: | chr1:18835563>18835779 |
miRNA location TIGR v5: | chr1:19239435>19239651 |
Folding energy: | -60.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** CUCCCUCCGU UUCACAAUAU AAGUUGUUUU AGACCAAAUU UUUUGUUUCA CAAUAUAAGU 60 (((((((((( (((((-(((( (((((((((( ((,,,,,,,, ,<<<<----< <<<<____>> UGUUUUCAAG UUUCUAUGCA AAUUAUAUAU UACUUUAAUA CUUUAUGAUU AUUUAUAUUC 120 >>>--->>>> ,,,,<<<<-< <<<<<-<<<< <<<<<<,,,, ,,,[[[[[__ __]]]]],,, UACAGUUUCU UUUAUAAUUG GCUGAACUUU UUAAAAGUAA AUAUUUUUAA UUUACGUGCU 180 ,,[[[[[--[ [____]]--] ]]]],,,,,, ,,,>>>>>-> >>>>--->>> >>>->>>>,, UUUAGCUAAA AUAAUUUAUA UCGUGAAACG GAGGGAG 217 ,,,,,))))) )))))))))) )-)))))))) )))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|2353_89763+89904_1-25
- gnl|BL_ORD_ID|62_48497-48646_126-150