IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CACUCCCUCCGUUUCACAAUAUAAG |
encoded miRNA: | MIR89f |
Precursor location: | 3105 - 3324 (positive strand) |
precursor length: | 220 (73 basepairs) |
MIR position: | 1 - 25 (3105 - 3129) |
MIR length: | 25 (23 paired bases) |
miRNA location TIGR v3: | chr1:18835561>18835780 |
miRNA location TIGR v5: | chr1:19239433>19239652 |
Folding energy: | -62.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ***** CACUCCCUCC GUUUCACAAU AUAAGUUGUU UUAGACCAAA UUUUUUGUUU CACAAUAUAA 60 :((((((((( (((((((-(( (((((((((( ((((,,,,,, ,,,<<<<--- -<<<<<____ GUUGUUUUCA AGUUUCUAUG CAAAUUAUAU AUUACUUUAA UACUUUAUGA UUAUUUAUAU 120 >>>>>--->> >>,,,,<<<< -<<<<<<-<< <<<<<<<<,, ,,,,,[[[[[ ____]]]]], UCUACAGUUU CUUUUAUAAU UGGCUGAACU UUUUAAAAGU AAAUAUUUUU AAUUUACGUG 180 ,,,,[[[[[- -[[____]]- -]]]]],,,, ,,,,,>>>>> ->>>>>---> >>>>>->>>> CUUUUAGCUA AAAUAAUUUA UAUCGUGAAA CGGAGGGAGU 220 ,,,,,,,))) )))))))))) )))-)))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|1732_67067-67220_130-154
- gnl|BL_ORD_ID|1732_67067+67219_1-25