IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UUAUAUUGUGAAACGGAGGGAGUG |
encoded miRNA: | MIR89e |
Precursor location: | 3105 - 3325 (negative strand) |
precursor length: | 221 (74 basepairs) |
MIR position: | 198 - 221 (3105 - 3128) |
MIR length: | 24 (24 paired bases) |
miRNA location TIGR v3: | chr1:18835561<18835781 |
miRNA location TIGR v5: | chr1:19239433<19239653 |
Folding energy: | -57.54 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCCUCC GUUUCACGAU AUAAAUUAUU UUAGCUAAAA GCACGUAAAU UAAAAAUAUU 60 (((((((((( (((((((((( ((((-((-(( (((((((((, ,,,,<<<<<< <<,,,,[[[[ UACUUUUAAA AAGUUCAGCC AAUUAUAAAA GAAACUGUAG AAUAUAAAUA AUCAUAAAGU 120 [[-[[[[[-- -[[[[[____ __________ ]-]]]]-]]] ]]--]]]]]] ,,,,,,,,[[ AUUAAAGUAA UAUAUAAUUU GCAUAGAAAC UUGAAAACAA CUUAUAUUGU GAAACAAAAA 180 [[[[___]]] ]]],>>>>>> >>,,,,,,,, [[[---[[[[ ______]]]] ----]]],,, *** ********** ********** * AUUUGGUCUA AAACAACUUA UAUUGUGAAA CGGAGGGAGU G 221 ,)))))-))) )))-))-))) )))))))))) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|122_84242+84370_1-24
- gnl|BL_ORD_ID|122_84242-84371_107-130
- gnl|BL_ORD_ID|106_79292-79421_107-130
- gnl|BL_ORD_ID|106_79292+79420_1-24