IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | CACUCCCUCCGUUUCACAAUAUAA |
encoded miRNA: | MIR89 |
Precursor location: | 3105 - 3324 (positive strand) |
precursor length: | 220 (73 basepairs) |
MIR position: | 1 - 24 (3105 - 3128) |
MIR length: | 24 (22 paired bases) |
miRNA location TIGR v3: | chr1:18835561>18835780 |
miRNA location TIGR v5: | chr1:19239433>19239652 |
Folding energy: | -62.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster015 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** **** CACUCCCUCC GUUUCACAAU AUAAGUUGUU UUAGACCAAA UUUUUUGUUU CACAAUAUAA 60 :((((((((( (((((((-(( (((((((((( ((((,,,,,, ,,,<<<<--- -<<<<<____ GUUGUUUUCA AGUUUCUAUG CAAAUUAUAU AUUACUUUAA UACUUUAUGA UUAUUUAUAU 120 >>>>>--->> >>,,,,<<<< -<<<<<<-<< <<<<<<<<,, ,,,,,[[[[[ ____]]]]], UCUACAGUUU CUUUUAUAAU UGGCUGAACU UUUUAAAAGU AAAUAUUUUU AAUUUACGUG 180 ,,,,[[[[[- -[[____]]- -]]]]],,,, ,,,,,>>>>> ->>>>>---> >>>>>->>>> CUUUUAGCUA AAAUAAUUUA UAUCGUGAAA CGGAGGGAGU 220 ,,,,,,,))) )))))))))) )))-)))))) ))))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At3g28910.1 | 68410.m03313 myb family transcription factor | 4 | 1 |
Rice homologs
- gnl|BL_ORD_ID|122_84242+84370_1-24
- gnl|BL_ORD_ID|122_84242-84371_107-130
- gnl|BL_ORD_ID|106_79292-79421_107-130
- gnl|BL_ORD_ID|106_79292+79420_1-24