IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | UAUUGUGAAACGGAGGGAGUGC |
encoded miRNA: | MIR89b |
Precursor location: | 3104 - 3325 (negative strand) |
precursor length: | 222 (74 basepairs) |
MIR position: | 201 - 222 (3104 - 3125) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr1:18835560<18835781 |
miRNA location TIGR v5: | chr1:19239432<19239653 |
Folding energy: | -58.04 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCCUCC GUUUCACGAU AUAAAUUAUU UUAGCUAAAA GCACGUAAAU UAAAAAUAUU 60 (((((((((( (((((((((( ((((-((-(( (((((((((, ,,,,<<<<<< <<,,,,[[[[ UACUUUUAAA AAGUUCAGCC AAUUAUAAAA GAAACUGUAG AAUAUAAAUA AUCAUAAAGU 120 [[-[[[[[-- -[[[[[____ __________ ]-]]]]-]]] ]]--]]]]]] ,,,,,,,,[[ AUUAAAGUAA UAUAUAAUUU GCAUAGAAAC UUGAAAACAA CUUAUAUUGU GAAACAAAAA 180 [[[[___]]] ]]],>>>>>> >>,,,,,,,, [[[---[[[[ ______]]]] ----]]],,, ********** ********** ** AUUUGGUCUA AAACAACUUA UAUUGUGAAA CGGAGGGAGU GC 222 ,)))))-))) )))-))-))) )))))))))) )))))))))) ):
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3475_62200-62352_132-153
- gnl|BL_ORD_ID|50_62184-62336_132-153