IGR sequence: | igr3964#chr1#x1=18832457#l=4446 |
---|---|
Mature miRNA sequence: | GCACUCCCUCCGUUUCACAAUA |
encoded miRNA: | MIR89a |
Precursor location: | 3104 - 3324 (positive strand) |
precursor length: | 221 (73 basepairs) |
MIR position: | 1 - 22 (3104 - 3125) |
MIR length: | 22 (19 paired bases) |
miRNA location TIGR v3: | chr1:18835560>18835780 |
miRNA location TIGR v5: | chr1:19239432>19239652 |
Folding energy: | -62.30 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** ** GCACUCCCUC CGUUUCACAA UAUAAGUUGU UUUAGACCAA AUUUUUUGUU UCACAAUAUA 60 ::(((((((( ((((((((-( (((((((((( (((((,,,,, ,,,,<<<<-- --<<<<<___ AGUUGUUUUC AAGUUUCUAU GCAAAUUAUA UAUUACUUUA AUACUUUAUG AUUAUUUAUA 120 _>>>>>---> >>>,,,,<<< <-<<<<<<-< <<<<<<<<<, ,,,,,,[[[[ [____]]]]] UUCUACAGUU UCUUUUAUAA UUGGCUGAAC UUUUUAAAAG UAAAUAUUUU UAAUUUACGU 180 ,,,,,[[[[[ --[[____]] --]]]]],,, ,,,,,,>>>> >->>>>>--- >>>>>>->>> GCUUUUAGCU AAAAUAAUUU AUAUCGUGAA ACGGAGGGAG U 221 >,,,,,,,)) )))))))))) ))))-))))) )))))))))) )
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3475_62200-62352_132-153
- gnl|BL_ORD_ID|50_62184-62336_132-153