IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | AUUGUGAAACUGAGGGAGUA |
encoded miRNA: | MIR32 |
Precursor location: | 1238 - 1456 (negative strand) |
precursor length: | 219 (65 basepairs) |
MIR position: | 200 - 219 (1238 - 1257) |
MIR length: | 20 (19 paired bases) |
miRNA location TIGR v3: | chr5:19114063<19114281 |
miRNA location TIGR v5: | chr5:19523121<19523339 |
Folding energy: | -48.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster013 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
UACUCCUUUU GUUUUACAAU AUAAGUUGUU UUAGCUAAAA ACACACAAGU UAAGAAUAUU 60 (((((((((- (((((((((( ((((-((((( ((-(((((,, ,,,,,<<<<< <,,[[-[[[[ UACUUUUAAA AAGUUUAACC AAUUAUAAAA GAGACUGCAU UAUAGAAAUA AUCAUAAAAU 120 [-[[------ -[[[[[____ __________ _]]]]]---- ---]]]]]]] -]],,,,,,, AUUAAAAUUA UAUAAUUUGU AUAGAAACUU GAAAACAACU AAUAUUGUAA AAUAAAAAAG 180 ,,,,,,,[[[ [[[_____]] ]]]],>>>>> >,,,[[[[__ ____]]]],, ,,,,,,,,,, * ********** ********* UUAGUCCAAA ACAAAUUAUA UUGUGAAACU GAGGGAGUA 219 )))))--))) ))))-))))) )))))))))- )))))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At3g59060.1 | 68410.m06910 bHLH protein family | 2 | 1 |
2 | At3g59060.2 | 68410.m06911 bHLH protein family | 2 | 1 |
Rice homologs
- gnl|BL_ORD_ID|3396_23918+24070_1-20
- gnl|BL_ORD_ID|3396_23918-24070_134-153
- gnl|BL_ORD_ID|1786_39064+39192_1-20
- gnl|BL_ORD_ID|1786_39064-39192_110-129
- gnl|BL_ORD_ID|1131_123041+123172_1-20
- gnl|BL_ORD_ID|1131_123041-123172_113-132
- gnl|BL_ORD_ID|787_110512-110628_98-117
- gnl|BL_ORD_ID|787_110512+110631_1-20
- gnl|BL_ORD_ID|779_64080+64199_1-20
- gnl|BL_ORD_ID|779_64080-64196_98-117
- gnl|BL_ORD_ID|430_37663-37799_118-137
- gnl|BL_ORD_ID|430_37663+37799_1-20