IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | UACUCCCUCAGUUUCACAAU |
encoded miRNA: | MIR32e |
Precursor location: | 1238 - 1456 (positive strand) |
precursor length: | 219 (64 basepairs) |
MIR position: | 1 - 20 (1238 - 1257) |
MIR length: | 20 (15 paired bases) |
miRNA location TIGR v3: | chr5:19114063>19114281 |
miRNA location TIGR v5: | chr5:19523121>19523339 |
Folding energy: | -41.10 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | none |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
********** ********** UACUCCCUCA GUUUCACAAU AUAAUUUGUU UUGGACUAAC UUUUUUAUUU UACAAUAUUA 60 ((((((---- ((((-((((( ((((-((((( ((((-((((, ,,,,,,,,,, ,<<<<<____ GUUGUUUUCA AGUUUCUAUA CAAAUUAUAU AAUUUUAAUA UUUUAUGAUU AUUUCUAUAA 120 >>>>>,,,<< <<<<---<<< ,,[[[[[[[- [[[______] ]]-]]]]]]] ,,,,,,,,,, UGCAGUCUCU UUUAUAAUUG GUUAAACUUU UUAAAAGUAA AUAUUCUUAA CUUGUGUGUU 180 ,,,,,,,,[[ [[[[-----[ [_____]]-- -]]]]]],,, ,>>>---->> >>>>,,,,,, UUUAGCUAAA ACAACUUAUA UUGUAAAACA AAAGGAGUA 219 ,))))))))) ))))-))))) ))))-))))- ---))))))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
No Targets found for this miRNA
Rice homologs
- gnl|BL_ORD_ID|3396_23918+24070_1-20
- gnl|BL_ORD_ID|3396_23918-24070_134-153
- gnl|BL_ORD_ID|1786_39064+39192_1-20
- gnl|BL_ORD_ID|1786_39064-39192_110-129
- gnl|BL_ORD_ID|1131_123041+123172_1-20
- gnl|BL_ORD_ID|1131_123041-123172_113-132
- gnl|BL_ORD_ID|787_110512-110628_98-117
- gnl|BL_ORD_ID|787_110512+110631_1-20
- gnl|BL_ORD_ID|779_64080+64199_1-20
- gnl|BL_ORD_ID|779_64080-64196_98-117
- gnl|BL_ORD_ID|430_37663-37799_118-137
- gnl|BL_ORD_ID|430_37663+37799_1-20