IGR sequence: | igr3883#chr5#x1=19112826#l=3251 |
---|---|
Mature miRNA sequence: | AUUGUGAAACUGAGGGAGUAUU |
encoded miRNA: | MIR31 |
Precursor location: | 1236 - 1458 (negative strand) |
precursor length: | 223 (67 basepairs) |
MIR position: | 202 - 223 (1236 - 1257) |
MIR length: | 22 (21 paired bases) |
miRNA location TIGR v3: | chr5:19114061<19114283 |
miRNA location TIGR v5: | chr5:19523119<19523341 |
Folding energy: | -50.50 |
BLAST hit against RFAM Atha miRNAs: | none |
Belongs to miRNAs-targets cluster: | cluster012 |
Sequence and secondary structure:
Presumed mature miRNA positions are indicated by *'s.
AGUACUCCUU UUGUUUUACA AUAUAAGUUG UUUUAGCUAA AAACACACAA GUUAAGAAUA 60 (((((((((( (-(((((((( ((((((-((( ((((-((((( ,,,,,,,<<< <<<,,[[-[[ UUUACUUUUA AAAAGUUUAA CCAAUUAUAA AAGAGACUGC AUUAUAGAAA UAAUCAUAAA 120 [[[-[[---- ---[[[[[__ __________ ___]]]]]-- -----]]]]] ]]-]],,,,, AUAUUAAAAU UAUAUAAUUU GUAUAGAAAC UUGAAAACAA CUAAUAUUGU AAAAUAAAAA 180 ,,,,,,,,,[ [[[[[_____ ]]]]]],>>> >>>,,,[[[[ ______]]]] ,,,,,,,,,, ********* ********** *** AGUUAGUCCA AAACAAAUUA UAUUGUGAAA CUGAGGGAGU AUU 223 ,,)))))--) ))))))-))) )))))))))) )-)))))))) )))
Postscript file CT file PNG file fasta file Stockholm file
Targets:
Nr. | Gene | Description | mismatches | miRNAs |
---|---|---|---|---|
1 | At2g45670.1 | 68409.m05132 expressed protein | 3 | 2 |
2 | At2g45670.2 | 68409.m05133 expressed protein | 3 | 2 |
Rice homologs
- gnl|BL_ORD_ID|1259_106026-106181_135-156
- gnl|BL_ORD_ID|1259_106026+106181_1-22